Prevalence of the CCR5 delta32 mutation in the tundra Nenets of Yamal

  • Tatyana Ammosova Howard University
  • Andrey Sergeyevich Egorov Saint Petersburg State Pediatric Medical University
  • Elena Vladimirovna Fedorova Saint Petersburg State Pediatric Medical University
  • Sergey Lvovich Avrusin Saint Petersburg State Pediatric Medical University
  • Andrey Vyacheslavovich Santimov Saint Petersburg State Pediatric Medical University
  • Sergei Nekhai Howard University

Abstract

CCR5 delta 32 is a genetic variant of CCR5 - deletion mutation of a gene that has a specific impact on the adhesive function of T cells. It is believed that this mutation arose approximately two and a half thousand years ago and eventually spread in Europe. It has been hypothesized that this allele was favored by natural selection during the Black Death. In the heterozygotes, this mutation strongly reduces the chance of HIV infection In the homozygotes, it completely protects against HIV infection. CCR5 delta32 mutation in the heterozygous state occurs in Europe with a frequency of 5-14 %. The incidence of CCR5 delta32 outside of Europe is very low, and in many non-European ethnic groups it is completely absent. The prevalence of this mutation in the population of the Nenets has not previously investigated. It was assumed to have a lower frequency than in Europeans. We carried out an investigation with 54 blood samples of Nenets living in Yamalo-Nenets Autonomous District. DNA was extracted with was QIAamp DNA Mini Kit (QIAGEN) according to the manufacturer protocol. To identify the CCR5 delta32 deletion polymerase chain reaction was conducted using primers: CCR5-D32-F: 5`CTTCATTACACCTGCAGTC3`, CCR5-D32-R: 5`TGAAGATAAGCCTCACAGCC3` under the following conditions: 95˚-5’x1; 95˚-15” → 55˚-15” → 72˚-60”x40; 72˚-10’x1 → 4˚-∞. Products of the reaction were separated in 2 % aga-rose gel for 1.5 hours. Gel documentation was performed using a Gel Doc XR Plus (Bio-Rad, USA). The prevalence of CCR5 delta32 mutation in Nenets was found to be 9.3 %. This was a higher than expected frequency, and it corresponds to the average prevalence of CCR5 delta32 mutation in Europe. Our finding suggests possible European origin of the Nenets.